Quantcast
Viewing all articles
Browse latest Browse all 3231

Analyzing Older Illumina Paired-End Data

Hi all, I've got some reads from mid-2010 that I'd like to re-align. I'm not sure how best to proceed. These are from a Illumina Genome Analyzer IIx. They're 40-bp, paired-end. Here's what the text file of the raw reads looks like:

@ILLUMINA-B22060_0001:6:1:2:1931#0/2
ATTGATTCGTCACGCAGATTTCGAAACATTAAATGCAATC
+ILLUMINA-B22060_0001:6:1:2:1931#0/2
`aWabGSb`^`b^a]aaaY_\aaUDUaaG[`^a\Sa[a`B
@ILLUMINA-B22060_0001:6:1:2:545#0/2
CATCGCCGATCAGGTCACTTACCCGGAGAATTTTGATAGG
+ILLUMINA-B22060_0001:6:1:2:545#0/2
X__]^V_baYO\V\DYYPX\``]BBBBBBBBBBBBBBBBB
@ILLUMINA-B22060_0001:6:1:2:1500#0/2
TGGAGGGGAGCAAAGAACCGAAGCTGAAGTTGACTTTCTT
+ILLUMINA-B22060_0001:6:1:2:1500#0/2
]_aGab`abZ[bbbaa`a^a[`a^\a\aYDH\a_IRSYX]

I'm assuming this isn't a standard fasta/fastq format, but I could be wrong. I'd like to align these with bowtie. Is there a simple way to convert these to fastq or fasta?

Thanks in advance.


Viewing all articles
Browse latest Browse all 3231

Trending Articles